EST details — SGN-E208594

Search information 
Request: 208594Match: SGN-E208594
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7715Clone name: cLEC-39-P4
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183934 is on microarray TOM1: SGN-S1-1-5.4.19.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183934 [TUS-43-H12] Trace: SGN-T1794 EST: SGN-E378221 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183934 [TUS-43-H12] Trace: SGN-T198108 EST: SGN-E396782 Direction: 3' Facility: INRA
Clone: SGN-C183934 [TUS-43-H12] Trace: SGN-T199923 EST: SGN-E398597 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208594Length: 298 bp (734 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208594 [] (trimmed) GGAGTGAGAAAAGCGAGCATAAGTGTAAGGCCAGCGGAAAAGTTACTTCCTATACATATAATAACTATACTTCTGGTTACATCCACCACTGTAAT
ATCAAAAATTTGAAGTTTGATACCAAATACTACTATAAGATTGGGATTGGACATATATCACGAACCTTCTGGTTCACAACTCCTCCAGAAGTCGG
CCCTGATGTACCCTATACATTAGGTCTTATAGGGGATCTTGGTCACAGTTTTGATTCATACAAGACACTCACACATTATGAATTAAATGCAATTA
ATGGGCAAGCCGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208594] SGN-U576865 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31884 [Download][View] Facility Assigned ID: TCAFZ86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0221 Quality Trim Threshold: 14.5