EST details — SGN-E208428

Search information 
Request: 208428Match: SGN-E208428
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7153Clone name: cLEC-37-P5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174168 is on microarray TOM1: SGN-S1-1-3.1.16.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174168 [TUS-18-A14] Trace: SGN-T189232 EST: SGN-E376618 Direction: 3' Facility: INRA
Clone: SGN-C174168 [TUS-18-A14] Trace: SGN-T189233 EST: SGN-E376619 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208428Length: 365 bp (768 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208428 [] (trimmed) GGACAAAGTGCGTGTTTTGCAACGATGGTAAGATGAAGAAAGAAACAGGATTAGTATACTGCAAAGGTTGCAAGGGTGCAGGATTAATACTCTGC
AAGAAATGTGCTGGTGCTGGATACTCAAAAAGGCTCTAACATATACTACTTGGACTCTTTGTTGCTCTAACTATTGACTTGTGTTCTGAGGCTAA
ATCACACATACAAGCTCACATATGAGGCTATCTCATTTTGGTTAAATCATATATTCCTCTTGAAAAAGGAAGGGTTACTACTACTTTTAATCCCT
AGATTATTGGTAGATTATATCTGTCTAAGCACATTTAACCTTTAGTCAATCGAATGTTATAGCTGATTACAATATGATGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208428] SGN-U581445 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31419 [Download][View] Facility Assigned ID: TCAFQ87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0370 Quality Trim Threshold: 12.5