EST details — SGN-E208204

Search information 
Request: 208204Match: SGN-E208204
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6919Clone name: cLEC-37-E14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174069 is on microarray TOM1: SGN-S1-1-6.1.17.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174069 [TUS-17-M11] Trace: SGN-T191453 EST: SGN-E390127 Direction: 5' Facility: INRA
Clone: SGN-C174069 [TUS-17-M11] Trace: SGN-T191656 EST: SGN-E390330 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208204Length: 197 bp (932 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208204 [] (trimmed) TTGTACTAAATTCGCTTCGATATAAAAATTCATAACCAAAATTCAAAATGTATTCAAATTGTGAACTAGAAAATGATTTTTCAGTACTCGAATCA
ATTAGAAGATACTTACTTGAAGATTGGGAAGCTCCATTAACGAGCTCTGAAAACTCAACATCCTCAGAGTTCAGCCGGAGCAACAGCATTGAATC
CAATATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208204] SGN-U569393 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31195 [Download][View] Facility Assigned ID: TCAFP31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0294 Quality Trim Threshold: 14.5