EST details — SGN-E208189

Search information 
Request: 208189Match: SGN-E208189
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C7137Clone name: cLEC-37-O5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C185606 is on microarray TOM1: SGN-S1-1-5.2.9.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185606 [TUS-47-N4] Trace: SGN-T192503 EST: SGN-E391177 Direction: 5' Facility: INRA
Clone: SGN-C185606 [TUS-47-N4] Trace: SGN-T192686 EST: SGN-E391360 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208189Length: 451 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E208189 [] (trimmed) GAGAGATAAAGCTTCTTCGTCACATGGATCATGACAATGTGATTGCCATTAGAGATATCATCAGGCCACCACAAACTGAGAATTTCAATGATGTC
TACATTGTTTATGAGCTGATGGACACTGATCTTCATCAGATAGTTCGTTCCAACCAACAGTTGACTGATGATCACTGTCGGTATTTCCTATACCA
AATATTACGAGGACTCAAGTACATTCACTCTGCCAATGTCCTGCATCGTGATATAAAACCCAGCAATTTATTTCTCAATGCAAACTGTGACCTAA
AAGTTGGAGATTTTGGGCTTGCAAGGACAACATCTGAAACAGATTTCATGACAGAGTATGTTGTAACACGCTGGTGTCGTGCACCGGAGTTGCTC
CTAAATTGTTCAGAATACACAGCATCGATTGATATCTGGTCAGTTGGTTGCATACTGGGTGAGATGATGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208189] SGN-U577109 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31180 [Download][View] Facility Assigned ID: TCAFO87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5