EST details — SGN-E207772

Search information 
Request: 207772Match: SGN-E207772
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5684Clone name: cLEC-32-K24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173844 is on microarray TOM1: SGN-S1-1-7.4.18.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173844 [TUS-17-D2] Trace: SGN-T197062 EST: SGN-E395736 Direction: 3' Facility: INRA
Clone: SGN-C173844 [TUS-17-D2] Trace: SGN-T197063 EST: SGN-E395737 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207772Length: 499 bp (844 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207772 [] (trimmed) GGAATCCCATACAAACAATCTTGTCGACGATGGCAACGCCGATGGCTGAGGATAGCAACTTCGAAGATGACCAGCTCCATGCTATGTCCACTGAA
GATATTATTAGGGCTTCTCGCCTTCTTGACAATGAAATTCGAATCATAAAGGAAGAGCTGCAGAGGACGAATCTAGAGTTGGATTCATTCAAGGA
GAAGATAAAGGAGAACCAAGAAAAAATTAAGCTCAATAAGCAACTTCCTTACTTGGTCGGCAACATTGTTGAGATTTTGGAAATGAATCCTGAAG
AAGAAGCTGAGGAGGATGGTGCAAATATTGATCTCGACTCACAAAGGAAGGGCAAGTGTGTTGTACTGAAAACATCCACACGCCAGACAATTTTC
TTGCCTGTTGTTGGTCTTGTTGATCCTGACAACTTAAAACCTGGTGATCTGGTTGGAGTAAATAAAGACAGTTATTTGATATTGGACACCTTGCC
ATCTGAATATGATTCTCGGGTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207772] SGN-U575333 Tomato 200607 Build 2 61 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29985 [Download][View] Facility Assigned ID: TCAEV72THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0153 Quality Trim Threshold: 14.5