EST details — SGN-E207582

Search information 
Request: 207582Match: SGN-E207582
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C5685Clone name: cLEC-32-K3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173845 is on microarray TOM1: SGN-S1-1-6.4.18.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173845 [TUS-17-D3] Trace: SGN-T189124 EST: SGN-E376510 Direction: 3' Facility: INRA
Clone: SGN-C173845 [TUS-17-D3] Trace: SGN-T189125 EST: SGN-E376511 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207582Length: 409 bp (731 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207582 [] (trimmed) AATAAATCTGGCGCCCAGGTTATGGATTCTTATCTGAAAGTGCTGATTTTGCTCAACTTTGTGAAAATGAGAATCTCTTATTTATTGGACCTCCT
GCATCTGCGATTCGTGACATGGGTGATAAAAGTGCTTCAAAGAGAATAATGGGTGCAGCTGGGGTTCCACTTGTGCCTGGATATCATGGTGATGA
GCAAGATATTGACTTTATGAAGTTGGAAGCAGACAAGATTGGGTATCCTATTTTAATTAAGCCAACCCATGGAGGTGGAGGGAAGGGTATGAGGA
TTGTTCAGAGTCCAAATGAATTTGCGGACTCATTCTTGGGGGCCCAACGTGAGGCAGCTGCATCATTTGGTATAAGTACAATCCTACTGGAGAAA
TATATTACTAAACCAAGACATATTGAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207582] SGN-U576744 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29795 [Download][View] Facility Assigned ID: TCAEU62THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0008 Quality Trim Threshold: 14.5