EST details — SGN-E207532

Search information 
Request: 207532Match: SGN-E207532
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C6758Clone name: cLEC-36-J8
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C181938 is on microarray TOM1: SGN-S1-1-1.1.10.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181938 [TUS-38-E8] Trace: SGN-T194574 EST: SGN-E393248 Direction: 5' Facility: INRA
Clone: SGN-C181938 [TUS-38-E8] Trace: SGN-T194790 EST: SGN-E393464 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207532Length: 398 bp (919 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E207532 [] (trimmed) TGAGACTACCAATGCGGTGAAATTGGATAACGAGAATGCAGTAAACGTCGATCATTATTATGGCAAGGGCTATGGCAAACGTAAGAAATGTTACA
GTTGCTGCAAAAAATACAAATATGGATGCAAAAAATACTGCTGCTCTTATGAAGAATATGTTGCTGCCCAGACTCAAAACTAAATAATTAATTAG
TGCTTAATTATGTGTATTTATTATTATTGTAAACTTTTGAAATTAAGTGACAAGATAATAATAATCTTGCTACTTAATTAAGACCCTTTGCTTGT
AACAAGTATGAATAAAGCCATTCATTTACGTACTATGAATGGTTGGTCATGATGTAATGTTTTGTTGTACAATATATATCATATTGTGTTTAAAA
ATGTTTCCATAACGTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207532] SGN-U578947 Tomato 200607 Build 2 200 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31120 [Download][View] Facility Assigned ID: TCAFN52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.906 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5