Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-C2067

Search information 
Request: 2067Match: SGN-C2067
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C2067Clone name: cLEC-14-L2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173326 is on microarray TOM1: SGN-S1-1-5.2.20.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173326 [TUS-15-N12] Trace: SGN-T189028 EST: SGN-E375414 Direction: 3' Facility: INRA
Clone: SGN-C173326 [TUS-15-N12] Trace: SGN-T189029 EST: SGN-E375415 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204904Length: 311 bp (875 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204904 [] (trimmed) AATAACGAAGTCATAATTTTGTTATTCAAGTTCAATCCAACATGGTTGAGCATGATTTTCATCAACAAACTCAAAGTTTAGTTAAGTTGGTGGTA
CTTGTATGTTTGTTATTTCTATCTGCTAGTATTTCAGTTGAAGCGCGAATTCGTCATTATCAATGGGAAGTTAAATATGAATATAAATCCCCAGA
TTGTTTCAAAAAACTCTCTATTAGCATCAATGGTAAAACTCCACGACCTACTATTGTTGCTCAACAAGGGGACACTGTTGTTGTTGAAGTTAAAA
ATAGCTTGTTAACTGAAAATCTTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204904] SGN-U581990 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26520 [Download][View] Facility Assigned ID: TCACD61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0118 Quality Trim Threshold: 14.5