EST details — SGN-E206470

Search information 
Request: 206470Match: SGN-E206470
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4127Clone name: cLEC-23-K12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183372 is on microarray TOM1: SGN-S1-1-7.1.2.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T1757 EST: SGN-E378616 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T195002 EST: SGN-E393676 Direction: 5' Facility: INRA
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T195977 EST: SGN-E394651 Direction: 3' Facility: INRA
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T195999 EST: SGN-E394673 Direction: 5' Facility: INRA
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T195999 EST: SGN-E399211 Direction: 5' Facility: INRA
Clone: SGN-C183372 [TUS-42-A2] Trace: SGN-T200265 EST: SGN-E399210 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206470Length: 519 bp (920 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E206470 [] (trimmed) TCGAGGAATTGTCTCAAACAACAAGATCTGCAAGTAGCTTAAATATGCTTCTAACAGGGCCATGGCTGAAAATCAAAAAACATTTCTCAAGTCAG
TACAAGAACTAGCAAATGAAAATCAAGTTCCAGAAAAGTATATTCATACACAAGGGTCAATCAATAGCTCTTGTCCCATGCTGAATGTGCCAGTA
GTTGACCTTAGACTTCTCACATCCACTGCCTGAAAACAAGAGCTCAACAAACTTCAATCAGGCCTCAAGTTTTGTGGCTGCATTCAAGTCATAAA
TCACGGACTAGCAGATTCATTTCTTGACAAAGTGCATGAAATTAGCAAACAGTTCTTTGCTCTTCCAGCTGAAGAGAAGCTTAAATATGCCAGAT
CAGTTGATGACATTTATGGATACGGAAACGATTCAGTTCTTTCAGATAAGCAAAAGCTTGATTGGACTGACAGATTGTATCTAAATGTGTTTCCT
GAAGCTATAAGAGACCTCAAATTGTGGCCCCAAAAACCTGAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206470] SGN-U563058 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28429 [Download][View] Facility Assigned ID: TCADL66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0181 Quality Trim Threshold: 14.5