Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E205778

Search information 
Request: 205778Match: SGN-E205778
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3306Clone name: cLEC-20-C3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173520 is on microarray TOM1: SGN-S1-1-3.2.18.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173520 [TUS-16-F14] Trace: SGN-T196915 EST: SGN-E395589 Direction: 3' Facility: INRA
Clone: SGN-C173520 [TUS-16-F14] Trace: SGN-T196916 EST: SGN-E395590 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205778Length: 477 bp (876 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E205778 [] (trimmed) AATCAAAGTTGGCAGTAACATGCTTCCATAGACAGGTGCAGCAAATAGAACTAGCGCTTCAAACAAACAGAATTAGTTTAAACTACTAATACAAA
GTATGATCAGCTAGCATCTCGAAATCAGAAGCTTCATTTCAGTGATTCTACAATTACTATTGATAAGATTGCACTCCTAGCCAAGCCAGAACAAT
TTCCTCAAGAGCTGGTCTGATAGTTTGCGTCAACATGTTTTGGTAATCAATCACATCACCACTTGACCTACTCAGTTCAATGAAGTAATTGGATA
CGGAAATTTCAAAGATTTGCACGCCAATGCACAGGGTCTCATATCTGCTCTCATTTAATCCCTCTAATATAAGAAATCCACCTTCTTTCTTCTTT
ACTTCAAGGTTCAGACTCCTGCCAACTTCCACAAGTTTGGATATGATGACTGGGACAGGTTCCACTGATGTAAAAAGCAGCTCCTCCTTTTGATC
AT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205778] SGN-U572172 Tomato 200607 Build 2 62 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T27560 [Download][View] Facility Assigned ID: TCACY14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0129 Quality Trim Threshold: 14.5