EST details — SGN-E205401

Search information 
Request: 205401Match: SGN-E205401
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C4681Clone name: cLEC-28-K21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C186591 [TUS-50-G5] Trace: SGN-T351619 EST: SGN-E550744 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205401Length: 368 bp (939 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E205401 [] (trimmed) CTTCTTCTCTTCATCAAAAGCATTTTTCTTTCTATTTTTCACATTGTCTATAGCATCAAGACTAGTCTTGGCACACGATTGTGGGTGTTCATCGG
ATTTGTGTTGCAGTAAATGGGGTTATTGTGGAAGTGGAAATGATTATTGTGGTGAAGGGTGTCAAGGGGGACCTTGTTTTATTACTACTCCCAGC
AATAATAATAATGGAGTTATAGTTTCTGATGTTGTGACTAATGCATTCTTTAATGGAATTGCTGATCAAGGTGCTTCTAGTTGTGAAGGAAAAGG
GTTTTATACACGAGAGAGATTTCTTGAAGCTCTTCAATCTTACAGTAATTTTGGAACTGTTGGCTCTACTGATGATTCTCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205401] SGN-U567041 Tomato 200607 Build 2 34 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28888 [Download][View] Facility Assigned ID: TCAEE71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0242 Quality Trim Threshold: 14.5