EST details — SGN-E205016

Search information 
Request: 205016Match: SGN-E205016
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2534Clone name: cLEC-16-F23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173424 is on microarray TOM1: SGN-S1-1-3.2.18.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173424 [TUS-16-B14] Trace: SGN-T196823 EST: SGN-E395497 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E205016Length: 464 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E205016 [] (trimmed) TCTCGCAAACCTCCTTGAACGTATACATTTCGAATACAAACAAATACAAACACAAGACGAGCTACCTTGATAAAAGAGCAGCTTCGCCAAAGTCA
CAAGCCACAAGAGGCACACTGGAGACTGTAACATAAAACTTAATCGCCTGAAACATACCGCTTCTCTGCATAGTACTTCTTCTCGCTTGCTTCTT
TTTTGGTGTTCCTTTTCACATATATCTCGGGGTTGGCAATGATTCTTTGAGCAACTGAAGTGGTTATAATGTCTTTAGGGCTCTCAATTACTCGG
AAGATTCCCATGTTTTTAGGAACTGCATAGGGATCATGTTCTTCTCCTGTAGAAGAGTTCCTTTCAGAAACTGTCCCATGTACAACCACAGAAAT
ATTGAAAGTTGTTACCATATCGTGGGTCACTTCCCAAGGGGCACCAATAATGACCTCATCAACATAGCGGCAGGCAAGTACACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E205016] SGN-U569482 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26905 [Download][View] Facility Assigned ID: TCACK36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0174 Quality Trim Threshold: 14.5