EST details — SGN-E204736

Search information 
Request: 204736Match: SGN-E204736
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1976Clone name: cLEC-14-H18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173286 is on microarray TOM1: SGN-S1-1-5.4.19.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173286 [TUS-15-L20] Trace: SGN-T189023 EST: SGN-E375409 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204736Length: 342 bp (893 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E204736 [] (trimmed) TAGAAATAGTCCTATTCAGGCAAGATTGCCTGTCAAAGAAGATATTGCTGTGATCATGTATACAAGTGGCAGTACAGGCTTGCCTAAGGGTGTTA
TGATAACTCATGGCAACATTGTAGCCACTGCAGCTGCTGTGATGACTGTGATTCCAAAACTTGGAACCAGTGATGTCTATTTGGCTTACCTTCCT
TTAGCTCACGTTTTTGAGTTGGCTGCTGAGACTGTAATGCTGACTGCAGGTGCTTGTATTGGTTATGGCTCAGCCCTCACATTGACGGACACATC
TAACAAAGTCATGAAGGGGACCAAGGGAGATGCTACAGTTTTAAAACCTACTTTAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204736] SGN-U569341 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26352 [Download][View] Facility Assigned ID: TCACD45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0217 Quality Trim Threshold: 14.5