EST details — SGN-E204660

Search information 
Request: 204660Match: SGN-E204660
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C2094Clone name: cLEC-14-M24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173345 is on microarray TOM1: SGN-S1-1-2.3.20.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173345 [TUS-15-O7] Trace: SGN-T188612 EST: SGN-E374968 Direction: 3' Facility: INRA
Clone: SGN-C173345 [TUS-15-O7] Trace: SGN-T188613 EST: SGN-E374969 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204660Length: 393 bp (853 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204660 [] (trimmed) GATGATTCCTCTTGCTCTAAATACACTCATGAAACTCTTTCATCATGGTGTCATAATTTACAAGAACTTCCATTGATTCCTACTAATTCTTGTTG
TTGGTCTCAACAGTTTTCTGCTTCTAGGAGCCATAGTGAAGCTGAGAAAAGGCGCAGAGACAGAATTAATGCTCAGCTTTCTACTCTTAGAAAAC
TCATTCCCACTTCTGAAAAGATGGATAAGGCAGGTCTACTAAGAAGTGTTGTTGAGCATGTTAAAGATCTGGAAGGAAAAGCAAAAGAAATGAGC
AATGTATTGAACACTCCAAGTGACATTGATGAAGTAGTAATTGAGGAAGAAGATGAAAGTTCCAACAACAACAACATAGTTGTGAAGGTTTCTTT
TTCGTGTGATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204660] SGN-U576530 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26276 [Download][View] Facility Assigned ID: TCACB84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0128 Quality Trim Threshold: 14.5