EST details — SGN-E204300

Search information 
Request: 204300Match: SGN-E204300
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1813Clone name: cLEC-13-P24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C184965 is on microarray TOM1: SGN-S1-1-6.3.12.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184965 [TUS-46-C11] Trace: SGN-T198890 EST: SGN-E397564 Direction: 3' Facility: INRA
Clone: SGN-C184965 [TUS-46-C11] Trace: SGN-T198891 EST: SGN-E397565 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204300Length: 454 bp (921 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204300 [] (trimmed) ATTCAATGACTGTGGTTCCTGGCAAGACTTATAGGCTTAGAATTGGCAGCTTGACTGCTCTTTCAGCTCTAAGTTTTGAAATTGAGGGGCATAAC
ATGACAGTTGTTGAGGCAGACGGTCACTATGTGGAGCCATTTGTGGTAAAAAATCTGTTCATTTATTCTGGAGAAACATACTCAGTCCTAATTAA
AGCTGATCAAGACCCTACAAGAAATTATTGGGCAAGTACAAAAGTTGTCAGCAGGAATAATACTACTCCAAATGGTTTGGGTATTTTCAATTATT
ACCCAAACCATCCTAGGAGATATCCTCCTACTGTACCACCCTCGGGGCCACGTTGGGATGACGTTGCCCCCAGGATGGCTCAGAGTGTTGCTATC
AAGTCCCACAGAGATTTCATCCATGCCCCTCCTCTGACATCGGACAGGGTCATAGTCATGCTCAACACACAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204300] SGN-U581990 Tomato 200607 Build 2 45 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T26053 [Download][View] Facility Assigned ID: TCABZ96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0156 Quality Trim Threshold: 14.5