EST details — SGN-E204235

Search information 
Request: 204235Match: SGN-E204235
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1692Clone name: cLEC-13-J19
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183806 is on microarray TOM1: SGN-S1-1-5.3.19.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183806 [TUS-43-C4] Trace: SGN-T196842 EST: SGN-E395516 Direction: 3' Facility: INRA
Clone: SGN-C183806 [TUS-43-C4] Trace: SGN-T196843 EST: SGN-E395517 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E204235Length: 561 bp (865 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E204235 [] (trimmed) CGCTGTCATACCAAAAAGGACAAATTTTTGTCTAGCTTTTTTCAAGTATATTATTTTTTTTAATTTTCTCAATTGAAAAGAAACATATATACACC
TATGTTTTATCTTTCTTGAAATTCGAAAAATTTTAACAAAAAATTATTCTTGTAAACACTTGTGCAGTGTTTCTTTTGCTGTTGTTTTGTTTTAC
AGATGGGTAACTGTTTAGGTTCATCAGCTAGAGTTGATGCCACTCTCAGCTCTCACAATATTTCTGCTTCCGGAGCCTCTAGGATTCCCAGCAGA
ACCAGCCATTCTTCTGTTCTTTCAAGTCTAAGTATTCCATCTTATAGTCGGAAAAGCAGCGCTGATACTCTTTCTACTCCAAGATCTGAAGGCGA
GATTTTGTTTTCTCCCAATGTTAAGTCCTTCTCATTTAACGAATTGAAAAGTGCAACAAGGAACTTTAGACCTGACAGTCTTCTTGGCGAAGGAG
GATTTGGTTATGTTTTCAAAGGATGGATTGATGAACATACTCTTACTGCTGCAAAGCCTGTTTCTGGAATGGTCATTGCGTTCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E204235] SGN-U582402 Tomato 200607 Build 2 28 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25988 [Download][View] Facility Assigned ID: TCABY58TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5