EST details — SGN-E203997

Search information 
Request: 203997Match: SGN-E203997
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3829Clone name: cLEC-22-E15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C184060 is on microarray TOM1: SGN-S1-1-7.1.18.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184060 [TUS-43-M18] Trace: SGN-T197904 EST: SGN-E396578 Direction: 5' Facility: INRA
Clone: SGN-C184060 [TUS-43-M18] Trace: SGN-T199914 EST: SGN-E398588 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203997Length: 334 bp (790 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203997 [] (trimmed) CCTAAGTCAGTCTCATTTGTATGGCTGCTTATCATTTTAATGACAATTCTCCTTCATTAGAAAATCTTTCACCCACTGGGGGAGGAAGTAGCACT
AGGCATCCCAATTTCAGAGGAATTCGACAGAGGAATGGGAAATGGGTCTCCGAAATTCGCGAGCCTCGAAAGACCACACGTATATGGTTAGGTAC
TTTTCCCATTCCTGAAATGGCAGCTGTCGCTTACGATGTTGCAGCTTTGGCATTAAAAGGTCCTGATGCGCAATTAAACTTTCCTGATCGTGCAT
ACTCCTACCCTGTCCCTGCTTCTCTGTCAGCCGCAGATATTCGTACTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203997] SGN-U574499 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28161 [Download][View] Facility Assigned ID: TCADG32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5