EST details — SGN-E203968

Search information 
Request: 203968Match: SGN-E203968
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C3830Clone name: cLEC-22-E16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C182460 is on microarray TOM1: SGN-S1-1-7.3.8.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182460 [TUS-39-K2] Trace: SGN-T1725 EST: SGN-E378605 Direction: 5' Facility: Giov. Lab
Clone: SGN-C182460 [TUS-39-K2] Trace: SGN-T194886 EST: SGN-E393560 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203968Length: 551 bp (804 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E203968 [] (trimmed) CCTAAGTCAGGCTCATTTGTATGGCTGCTTATCATTTTAATGACAATTCTCCTTCATTAGAAAATCTTTCACCCACTGGGGGAGGAAGTAGCACT
AGGCATCCCAATTTCAGAGGAATTCGACAGAGGAATGGGAAATGGGTCTCCGAAATTCGCGAGCCTCGAAAGACCACACGTATATGGTTAGGTAC
TTTTCCCATTCCTGAAATGGCAGCTGTCGCTTACGATGTTGCAGCTTTGGCATTAAAAGGTCCTGATGCGCAATTAAACTTTCCTGATCGTGCAT
ACTCCTACCCTGTCCCTGCTTCTCTGTCAGCCGCAGATATTCGTACTGCGGCTGCTAATGCTGCTGCTGCTAGAGCACCTCCTTTGTCAGAAATC
AATACAGCAGCAGGAGGAGGACAAGGGCAAGAGTTTGTGGACGAAGAGGAAATATTTGGAATGCCGAAATTGCTTGATGATATGGCAGAGGCAAT
GCTTGTTAGCCCGCCAAGGATGCATCAGTACGACGAATCACCTGAAAACTCTGATGCAGATAGTCTCTGGGGTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203968] SGN-U574499 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T28132 [Download][View] Facility Assigned ID: TCADH32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5