Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E203312

Search information 
Request: 203312Match: SGN-E203312
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C448Clone name: cLEB-3-H5
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C448 [cLEB-3-H5] Trace: SGN-T23057 EST: SGN-E203311 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203312Length: 447 bp (580 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E203312 [] (trimmed) AGAAACATGTTGGTGAGTAGATGAAAATAACACTCAAATACAATGCCGCAATCCTCAATTTTCTCCTCCGTCCCTCTGTAGTTACAGCTCACCGT
TATTCAATATGCACACCCATGAGAATAGTTTTAGGAATGACAAGTCAAGTAAACAGTCTAACTTCTTGATTTTCCTGCTATCTCAAGTGCTCCTT
ACGGCACTAGGATGCTTTAGGTAATTTATATCTCTACCTTTGGTGGACCAGAGTGTCTCCTTGGTACACCACCAGGGGATGCTGAGAACGACAAT
CGCTTCTTCGTAGAACTAACACTTCCCTTCTCTGGTGTCCCTATCTTTTCGAAACCCAAAGGACTTGGTAAGCGGGACCTTGCTCGTGCTGATTC
TGTTGCAGCCATGTAACTTGGAACAGATGGGGAACTTGCCAGACTTTCATCATCTCTAACTGATGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203312] SGN-U601014 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23058 [Download][View] Facility Assigned ID: TSHAK39TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5