| SGN ID: SGN-C371 | Clone name: cLEB-3-D17 |  | Order Clone |
|
| Library Name: cLEB | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks
Microarray: Alias clone
SGN-C185870 is on microarray TOM1: SGN-S1-1-5.1.7.6
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E203075 | Length: 375 bp (730 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E203075 [] (trimmed)
ACCAAACAGTAGTTGAACTAAACCATAAGATGCAAGTTTTGAAATATTGTTCAACACCAGAAGTGTGACAACAAAAACATCAAGAGAGATTCAAA
CAGATACTATTAAGACTTTCCGCCCCCAAACAGAACAACAATTACAGCACACCTCCAACCCACCTTACAAAAATAAGCATCAACATACGACATTA
TCCCTACTATTAGATTTCATTACCAACTTTTTAAGTCTTCACAAAAAGAAAAATCTCAAAAGAGCAACAATAGAACTGCCATGGTTGATCAACTT
AAGCACGCTCGCCCCTAATACGCCTAGCAAGCTGAATGTCCTTGGGCATAATGGTCACACGCTTGGCATGAATGGCACAAAGATTGGTGT
[BLAST] [AA Translate]
| SGN-ID: SGN-T22821 [Download][View] |
Facility Assigned ID: TSHAK21TV
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
| Sequence Entropy: 0.945 |
Expected Error Rate: 0.0077 |
Quality Trim Threshold: 14.5 |
