EST details — SGN-E203074

Search information 
Request: 203074Match: SGN-E203074
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C371Clone name: cLEB-3-D17
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: Alias clone SGN-C185870 is on microarray TOM1: SGN-S1-1-5.1.7.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C371 [cLEB-3-D17] Trace: SGN-T22821 EST: SGN-E203075 Direction: 3' Facility: TIGR
Clone: SGN-C185870 [TUS-48-I4] Trace: SGN-T188425 EST: SGN-E376385 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E203074Length: 398 bp (883 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E203074 [] (trimmed) CTTGGGAGTCCAAGCGTCAGGAAGTTTGGAAGGGGAGCGTGAAATACTGCTAAAGATGGAGGAAGTAACCAATGTTACGGAGTATCAGGAGATCG
CCAAGAAAAAGTTGCCAAAGATGGTTTATGACTACTATGCCTCGGGAGCTGAGGACCAGTGGACTCTGGCTGAGAACAGAAACGCCTTCTCAAGA
ATTCTGTTTAGGCCCCGTATTCTCATTGATGTGAGCAAAATTGACATGACCACCACAGTGCTAGGATTCAAGATTTCAATGCCTATCATGATTGC
ACCAACAGCCATGCAGAAAATGGCACATCCTGAAGGGGAGTATGCTACAGCAAGAGCAGCATCAGCAGCAGGCACAATCATGACATTGTCATCCT
GTGCCACTTTCAGCGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E203074] SGN-U578941 Tomato 200607 Build 2 184 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T22820 [Download][View] Facility Assigned ID: TSHAK21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0208 Quality Trim Threshold: 14.5