EST details — SGN-E202534

Search information 
Request: 202534Match: SGN-E202534
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C11039Clone name: cLEC-6-P3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172849 is on microarray TOM1: SGN-S1-1-2.2.20.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172849 [TUS-14-J15] Trace: SGN-T195898 EST: SGN-E394572 Direction: 3' Facility: INRA
Clone: SGN-C172849 [TUS-14-J15] Trace: SGN-T195899 EST: SGN-E394573 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202534Length: 426 bp (620 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202534 [] (trimmed) GGAACAACTCGAACCATCAAAAACCAATAGCAATCAATCAATCAATCAAACCCAAAAAGGTGTGCGTGTGTGGGTGCAGAGCAAGAAATCAATGG
CGGAAGGTGGGGAGAAGAAGAGGGTTGTCGTGGAGTCGTTAGGATGGTTAACGGAATCCACCATCATGCCCAAAAAGATCCTACCAATTGAAGGC
GTTGGTGCTTTTTCCATCCTTGAGCTTAAAGCCCAATTATACAAATCTCAAGAATAGGCCAATCGCGTTATCAAAGAGACCGTCCACCCTTCTGC
TGCTGACCCGAATTATTCCCATCTAGAGATCCATCGTGCAAAGAGGAAGATAACTGCCAAGAACGTCTTTTCGTCTAAAAATCATGGGGTTGATG
CCAGATAGGCCAACGACAAGCTTGTGATGAAAGCGATGAATGATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202534] SGN-U574056 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24195 [Download][View] Facility Assigned ID: TCAAW86TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0189 Quality Trim Threshold: 14.5