EST details — SGN-E202377

Search information 
Request: 202377Match: SGN-E202377
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10857Clone name: cLEC-6-H2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172725 is on microarray TOM1: SGN-S1-1-6.1.20.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172725 [TUS-14-E11] Trace: SGN-T195113 EST: SGN-E393787 Direction: 3' Facility: INRA
Clone: SGN-C172725 [TUS-14-E11] Trace: SGN-T195566 EST: SGN-E394240 Direction: 3' Facility: INRA
Clone: SGN-C172725 [TUS-14-E11] Trace: SGN-T195566 EST: SGN-E398922 Direction: 3' Facility: INRA
Clone: SGN-C172725 [TUS-14-E11] Trace: SGN-T195567 EST: SGN-E394241 Direction: 5' Facility: INRA
Clone: SGN-C172725 [TUS-14-E11] Trace: SGN-T200173 EST: SGN-E398923 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202377Length: 529 bp (779 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202377 [] (trimmed) GGATGCCTTCACTGACACAGCATTCAAAGGGAACCCAGCTGCTGTTTGCTTATTGGAAGAAGAGAAAGATGATAAATGGTTACAATCTGTTGCTG
CTGAGTTTAATCTCTCTGAAACTTGTTATCTCATTCCGCTCATTGAACCTGCTAACACAAACCCCAGATTTGGCCTTCGTTGGTTCACTCCTGTT
GACGAGGTCGATTTATGTGGGCATGCAACACTAGCAGCAGCACACTTTCTATTTTCGTATGGCCTGGTTAAAACTGATACTATTGAGTTTTCAAC
AAGATCAGGAATTTTAATTGCCAAAAAGTACCAGAACCAAAAGTTTCAAATTCTCAGGACGATTGGCCAACTGGTTACTCAATTGAATTGGATTT
TCCTGTTGTCCAAGTAGCCGAGACCAATTTTAATGATGTTCTTGCAATTTCAAAGAGCTTGAATGGCGCATCTGTGGTTGAGATCTATGAGACAT
CAATGGGTGATCATTTTATTTTGCTCCCATCAGGGGNAGGAAGTGGTCGAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202377] SGN-U578696 Tomato 200607 Build 2 189 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24038 [Download][View] Facility Assigned ID: TCAAX37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0069 Quality Trim Threshold: 14.5