EST details — SGN-E202358

Search information 
Request: 202358Match: SGN-E202358
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10725Clone name: cLEC-6-B2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172636 is on microarray TOM1: SGN-S1-1-7.1.20.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195204 EST: SGN-E393878 Direction: 3' Facility: INRA
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195361 EST: SGN-E394035 Direction: 5' Facility: INRA
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195648 EST: SGN-E394322 Direction: 5' Facility: INRA
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195648 EST: SGN-E399017 Direction: 5' Facility: INRA
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195772 EST: SGN-E394446 Direction: 3' Facility: INRA
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195772 EST: SGN-E399016 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202358Length: 533 bp (782 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202358 [] (trimmed) CCACACACAACAAATTACAAAACAAAATATACTAAAATCTGTATTTTTAGCTTCTTTTCACCATCTAATCTCACAAAAATATCATCTTTCCCTGT
TTTATCGAGTAAATAAAGATTAGTTCCAACTGGATTTTGTTCCCTTTTCCCCTTCTCTCCATAACGAACCTAATTTGCAGTTCTGTATTTGGGGG
TTTTCTTCTTTTGGAAGAACAGAAAAAAAGGTGTCTTTTGTTTTACTTTTGGAGTTATTAAGATATGGCAATGACCAAAACCTTATCTATGATCT
CAAGAACAGGAAGAGACTTGCAGAGATACAATGATGGATGTCGTCAAGTTGTTGGATGCATTCCGTACAGATATAGAAAAACCAATCAATCATCT
ACAGTTCAAGGGACCCAAATTGATGATTTGGAATTCTTATTGATCAGCTCACAGAAGAGTCCAAAGTGGATGTTCCCTAAGGGTGGTTGGGAAAC
TGATGAGGCATTAGAAGATGCTGCTTTAAGAGAGACTTTTGAGGAATCTGGTGTAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202358] SGN-U580078 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24019 [Download][View] Facility Assigned ID: TCAAX01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5