Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E202208

Search information 
Request: 202208Match: SGN-E202208
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14297Clone name: cLEC-7-H2
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172926 is on microarray TOM1: SGN-S1-1-5.1.20.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172926 [TUS-14-M20] Trace: SGN-T195405 EST: SGN-E394079 Direction: 3' Facility: INRA
Clone: SGN-C172926 [TUS-14-M20] Trace: SGN-T195406 EST: SGN-E394080 Direction: 5' Facility: INRA
Clone: SGN-C172926 [TUS-14-M20] Trace: SGN-T195700 EST: SGN-E394374 Direction: 5' Facility: INRA
Clone: SGN-C172926 [TUS-14-M20] Trace: SGN-T195700 EST: SGN-E399097 Direction: 5' Facility: INRA
Clone: SGN-C172926 [TUS-14-M20] Trace: SGN-T200222 EST: SGN-E399096 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202208Length: 490 bp (970 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202208 [] (trimmed) GGAATGACCCCTTACCGGATTCTGACTCCCTTTTCTCTGGCAGCCACCGGAATTCTGCCTCTGACCTCTCGGCTGAGCTCTCAGTTCCGTATGAG
GATATTGTCCAGCTTGAATGGCTTTCAACATTTGTGGAGGATTCTTTCTCCGGCGGGGGATTGACTCTCGGGAAAGAAAACATTCCTGTTGAGAA
AGAGCCGTCATCCCAAGGCAAGTTCCAGACTTCGAGTCCTGTGTCTGTGCTTGAAAGCAGCAGCAGCAGCAGCTCGTCATTTTCCAGCTCGGGGG
AAAAAACTTTACCCCTTAGTCCATGCCACCGTGGTCCACAACGTGCTCGGACCAAGCGTCCTCGCCCAACAACTTTTAATCCCTTCCCAGTATTT
GTTGCTCCAGTTGTTCCAACAGAATCAGAGAATTTCGCGGAGTCTCCCATGAAGAAGATTCTGAAACCGGCTGAACCAGAACAGATAAAGAAAAA
GAAGATCAAATTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202208] SGN-U563049 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25490 [Download][View] Facility Assigned ID: TCABB37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0150 Quality Trim Threshold: 14.5