EST details — SGN-E202155

Search information 
Request: 202155Match: SGN-E202155
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14394Clone name: cLEC-7-M18
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183963 is on microarray TOM1: SGN-S1-1-8.1.18.5
See unigene SGN-U568929 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C183963 [TUS-43-I17] Trace: SGN-T196256 EST: SGN-E394930 Direction: 5' Facility: INRA
Clone: SGN-C183963 [TUS-43-I17] Trace: SGN-T199692 EST: SGN-E398366 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202155Length: 414 bp (751 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202155 [] (trimmed) GCAGTTGCTACCCTTCAATCTTTCTTTTCCCGATATAGCTTCTCTACTAACCCACCCCATATCTCTTCACTTTTTCCTGTCTTTAACTTCAACAA
TGAACATGACCCTTGTTGATTCACCTCAATTTCTACTTCTTCAAAAATGGGCCGCGGAAAAATTGAGATCAAGAAGATTGAAAACTCGACAAACA
GGCAGGTCACTTACTCCAAGAGAAGAAACGGCATTTTCAAGAAAGCTAAAGAACTTACTGTTCTTTGTGACGCTAAGAGCTCTCTCATCATGCTA
TCAAGCACCAGGAAGTATCATGAGTACACAAGCCCAAACACTACGACAAAAAAGATGATTGATCAGTATCAGAGTGCACTTGGAGTTGATATCTG
GAGCATTCACTACGAGTTTGTACATTGAATTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202155] SGN-U568929 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25437 [Download][View] Facility Assigned ID: TCAAZ81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0229 Quality Trim Threshold: 14.5