EST details — SGN-E202142

Search information 
Request: 202142Match: SGN-E202142
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14271Clone name: cLEC-7-G14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172911 is on microarray TOM1: SGN-S1-1-4.1.20.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195141 EST: SGN-E393815 Direction: 3' Facility: INRA
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195142 EST: SGN-E393816 Direction: 5' Facility: INRA
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195142 EST: SGN-E398975 Direction: 5' Facility: INRA
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195321 EST: SGN-E393995 Direction: 3' Facility: INRA
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195321 EST: SGN-E398974 Direction: 3' Facility: INRA
Clone: SGN-C172911 [TUS-14-M5] Trace: SGN-T195322 EST: SGN-E393996 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202142Length: 521 bp (747 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202142 [] (trimmed) ATCTTCTCTATCGACCATGTTGAGCCAACCTCACTGTGCTGTGCGCATCAAATTCCCTAAACAATATTCGGTCAGATTCCTTTCTTCGAAGCTTC
TTGAAGTTCAATCAACCTCCTCCCGCCGCACCTCAGTTTCTCTTGGGAGGAGTTCTACATTCTCTATCAAGATATCCAGGAATTTCTCGCAGTGT
CACTCCCGCACTTCCTTAACCAGCAAGAACCAAATTCCAACCCTCCGTGACTTCATACCCAAAGCTACTCAGACTGTTTCTTCTTCCGATGTTCA
GCAGGAGTCTGTGATGATATCTGACGTTATGCCTAGAGGACGCATCTATCATGAAACTTATGGATGTCAAATGAATGTCAATGATATGGAGATTG
TTTTATCCATCATGAAAAATGCTGGATACACTGAAAGTGTGGAAGTCCCAGAAAATGCTGAGATAATATTTATAAATACTTGTGCTATAAGGGAC
AATGCAGAACTTAAGGTTTGGCAGAAGCTCAATTATTTTTGGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202142] SGN-U563728 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25424 [Download][View] Facility Assigned ID: TCAAZ43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5