EST details — SGN-E202051

Search information 
Request: 202051Match: SGN-E202051
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14167Clone name: cLEC-7-B16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172863 is on microarray TOM1: SGN-S1-1-4.3.20.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T195752 EST: SGN-E394426 Direction: 3' Facility: INRA
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T195752 EST: SGN-E399525 Direction: 3' Facility: INRA
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T199437 EST: SGN-E398111 Direction: 3' Facility: INRA
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T199542 EST: SGN-E398216 Direction: 5' Facility: INRA
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T199586 EST: SGN-E398260 Direction: 5' Facility: INRA
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T199586 EST: SGN-E398958 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202051Length: 522 bp (958 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202051 [] (trimmed) GATAAGGCTTACAATGGTGTGATCCATACTTGCAAAATGCATGATATGGTTCGTGATTTGGTGATCAAAATTGCAGATGATGATTCATTTTCCAC
CCCATCTGATGCAAATTGTCGGCATTTGGGTATTAATAGTGCGATGAATGGGAAGCAACTACTGAGCAATCGAAAATTACGAGCACTGCTGACAA
CCACCAAGAGTGGTGAAGTAAACAAAATCCCTTCTGATATTGCTAGGAAGTTCTGCAATAGTCGACACCTCCAGGTACTGGATCTGTCCAAATCA
ATTTTCGATGTGCCTCTTTCAAGTTTGCTGGAAGGCATTGGATCTGCCAGACAGCTTGCTTATCTCAGTTTAAGCAATACACACCCGCTGATTGG
TGTTCCAGATTCCATATCCAATCTTGAAAAATTACAGATTTTGGACTTCAGCTATTGCCAGAATATGAAAATGCTCCCCTCTTGTGTTTTAACAT
TTGTGGAACTAGCAATTTTAGATTTGAACCACTGTGGGTCACTTGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202051] SGN-U565272 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25333 [Download][View] Facility Assigned ID: TCABB08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0115 Quality Trim Threshold: 14.5