EST details — SGN-E202041

Search information 
Request: 202041Match: SGN-E202041
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14417Clone name: cLEC-7-N23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172982 is on microarray TOM1: SGN-S1-1-5.4.20.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172982 [TUS-14-P4] Trace: SGN-T188126 EST: SGN-E374818 Direction: 3' Facility: INRA
Clone: SGN-C172982 [TUS-14-P4] Trace: SGN-T188127 EST: SGN-E374819 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202041Length: 345 bp (968 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202041 [] (trimmed) GCTGAGTCTTTTATGTCCCATTTTGATGAAGAATGCTCAGATGCTGGGATTGTCCAAGCAAAATGGGACTCATCAAGAGTGAAGGATAAGCTGAG
GCGTGATGTAGATGCTCATATTGCTGAAGTTCGCAGTGCCAAGCTGGCTGAAGTGACAACCCTGTATGAGACAAAACTGAACGAGGCATTGGCTG
GACCAGTTGAGGCTCTTTTAGATGGAGCTGGCGATGATACATGGCCGGCAATAAGAAAATTGCTTCAGCGTGAGACTGATACAGCAAGACTCTGG
TATTGCTGCTGCACTTTCTGGTTTTGAAATGGGATGAAGAAAGTGGGGGATACATGGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202041] SGN-U583680 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25323 [Download][View] Facility Assigned ID: TCABA84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5