EST details — SGN-E201700

Search information 
Request: 201700Match: SGN-E201700
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1374Clone name: cLEC-11-N20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183573 is on microarray TOM1: SGN-S1-1-6.1.1.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183573 [TUS-42-I11] Trace: SGN-T195957 EST: SGN-E394631 Direction: 3' Facility: INRA
Clone: SGN-C183573 [TUS-42-I11] Trace: SGN-T200248 EST: SGN-E399168 Direction: 5' Facility: INRA
Clone: SGN-C183573 [TUS-42-I11] Trace: SGN-T200247 EST: SGN-E399167 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201700Length: 384 bp (789 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201700 [] (trimmed) CTCTTTCATTTCCATCTTTGTGTTAATTTCCTCCATCCATTACTTCCCTCTATTTATTATTATTCCTTTCAATATTCCTCTCTTTCCATTTTATT
CATAAAAAATAAAAACTAAAAAAAGTTGAAAGTCATCTGAGGATTTGCAGGTGCAATGGCTCAACGTGTTCTAACTCGTGTTCACAGTCTTCGTG
AACGTCTTGATGCTACTTTGGATGCTCATCGCAATGAAATTTTGCTCTTTCTTTCAAGGATCGAAAGCCACGGGAAAGGGATCTTGAAACCTCAC
CAGCTACTGGCTGAGTTTGAATCAATTCAGAAAGAAGACAAAGACAAACTGAATGATCATGCCTTTGAAGAAGTCCTGAAATCCACTCAGGAAGC
AATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201700] SGN-U580181 Tomato 200607 Build 2 78 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25647 [Download][View] Facility Assigned ID: TCABR82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0003 Quality Trim Threshold: 14.5