EST details — SGN-E200742

Search information 
Request: 200742Match: SGN-E200742
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C14933Clone name: cLEC-9-K23
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C180872 is on microarray TOM1: SGN-S1-1-3.4.17.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180872 [TUS-35-H22] Trace: SGN-T1650 EST: SGN-E378200 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200742Length: 420 bp (843 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200742 [] (trimmed) GGACTTTGAGGGATAGAGGTCCTTATCCTCCAGATCAGGTTGTGAAGGATATTCATGGAAAGTTTGCATTCGTTCTTTATGATTGCGCTTCTAAG
AGTACCTTTCTAGCTTCTGATGTTGATGGCTGTGTGCCCTTCTTCTGGGGTACTGATTCTGAAGGCCACCTAGTTCTCTCAGATGATGCTGACAT
TGTGAAACAAGGCTGTGGGAAATCCTTTTCACCATTTCCCAAAGGGTGCTTTTTCACATCTTCTGGTGGCTTGAGGAGTTATGAACACCCACGCA
ATGAGTTGAAATCAGTACCGAGGGTGGACAGCTCAGGCGAGGTGTGTGGAGCAAATTTTAAGGTGGACCCACAGTCTAAGAAAGTGGATTCAGGC
ATGCCCAGAGTGGGTAGTGCTGCTAACTGGTCACAACACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200742] SGN-U577532 Tomato 200607 Build 2 85 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25036 [Download][View] Facility Assigned ID: TCABG72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0170 Quality Trim Threshold: 14.5