EST details — SGN-C19537

Search information 
Request: 19537Match: SGN-C19537
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C19537Clone name: cLED-27-C20
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181306 is on microarray TOM1: SGN-S1-1-1.2.14.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181306 [TUS-36-J24] Trace: SGN-T199269 EST: SGN-E397943 Direction: 5' Facility: INRA
Clone: SGN-C181306 [TUS-36-J24] Trace: SGN-T199285 EST: SGN-E397959 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E241985Length: 488 bp (1047 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E241985 [] (trimmed) GAATGGGGTTGATATTGTATCAGGCACCAGTGTGAGGACACATTTCGCCAGGCCGAATTGGAGGAAAGTATTTTCCAAGACCTTAACCAAGCATG
CAAATGCAAGAATAGGAGTTTTCTACTGTGGTGCACCCATATTAGCTAAAGAACTCAGCCAACTCTGCAAAGAGTTTAACCAAAAGGGCACAACA
AAGTTCGAGTTTCACAAAGAACATTTTTAGAAGGGCCTGGAGTATGATTAATCTTGCATCAACGGTACACACATCTATCTTCGGTACCTTATTTG
ATTATTCTACTGAAGAGATAACATTAGTAAGGAATAAGTCAGAGATAAATTGTACATAATAGGAAGAAGACTATTTCAAGAGAAAATACATACCA
ATAAGATGTGTATAGGTTTTTTATATTCAGTCATCTGTTATCACATACCAAACTTCAGAACTCCTAAAGGGAGACTCTGCTTTGGTCAGATGACT
TTAGAATATGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E241985] SGN-U564615 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T55704 [Download][View] Facility Assigned ID: TOVEB22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5