EST details — SGN-C18859

Search information 
Request: 18859Match: SGN-C18859
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C18859Clone name: cLED-24-M23
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C185012 is on microarray TOM1: SGN-S1-1-7.1.12.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185012 [TUS-46-E10] Trace: SGN-T1860 EST: SGN-E378234 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185012 [TUS-46-E10] Trace: SGN-T196579 EST: SGN-E395253 Direction: 5' Facility: INRA
Clone: SGN-C185012 [TUS-46-E10] Trace: SGN-T200092 EST: SGN-E398766 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E240916Length: 286 bp (753 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E240916 [] (trimmed) AACACAAAAAGGATTATATTAAAGATTGAATTGGTCTCATAAACCAAAAATGAAAACAAGCATACTGTGCCAAATAACAGCAACTCTTGAAAACT
ATTCAATTCTAGAAGTAACTAGACTTCGGTCTACAAAATGCATAAACAAAAAACTTGCTGTCAGATAAACTGATCCAGCAGTCGGCTCTCGACTT
ACTGGATGTTTGAGGACTTGTTAAGGATAACACCTTCATATTTGACCTGAAACCACTTCATTGAGTCCTCCTTTGTGACCCTGTGTTGGATCCCA
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E240916] SGN-U578115 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54813 [Download][View] Facility Assigned ID: TOVDO84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0212 Quality Trim Threshold: 14.5