EST details — SGN-C185927

Search information 
Request: 185927Match: SGN-C185927
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C185927Clone name: TUS-48-K13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185927 is on microarray TOM1 spot ID 1-1-4.3.7.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72942 [cLER-2-K4] Trace: SGN-T92485 EST: SGN-E278767 Direction: 5' Facility: TIGR
Clone: SGN-C185927 [TUS-48-K13] Trace: SGN-T188190 EST: SGN-E376150 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E376151Length: 198 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E376151 [] (trimmed) AGGTACAATTTTTCTTGCTGTATGACAATGTAGGAGGTTAGATTTGCTAGTGTGCACAAATCCCATCAAGCACACGCATGAATAGCAATCACTAA
TTTTGGAACCTTGACTCATCTCTCTGGATCTACAAATGCAGTGTGAAATGTTTCTTTTTATTCTTTTGGTTTTAATGAAGAAATGATTGGTTTCT
TTATGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E376151] SGN-U579007 Tomato 200607 Build 2 52 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T188191 [Download][View] Facility Assigned ID: FA0AAD36AF07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.877 Expected Error Rate: 0.0078 Quality Trim Threshold: 12.5