Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C185906

Search information 
Request: 185906Match: SGN-C185906
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C185906Clone name: TUS-48-J16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185906 is on microarray TOM1 spot ID 1-1-1.2.7.10 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72077 [cLER-1-B23] Trace: SGN-T92138 EST: SGN-E280584 Direction: 5' Facility: TIGR
Clone: SGN-C185906 [TUS-48-J16] Trace: SGN-T197791 EST: SGN-E396465 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378655Length: 385 bp (1118 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378655 [] (trimmed) TTTAAAAAAATGTCACAATTTTAACGGGATTGGGCCCCCCAAAAATAACCCCTTTTGGCTCCTTGGGGCAAAAAAAAAAAAGGGGTTTTTTAATT
TTAGGAAATGGGGACCATTGGGCCAATTTGGGGCAAGGCAAAAAAACCCAACCCCCCCCGGGGTTTTTTCCGGGGTTAAGGGAAAAAAAACCTGG
AAATTCCCCCCCTTGGGAAAAAGGGGGGAAAAAACTTTTTGGGGGGGGGGGGGCCCCCAAAAAAAAAAAAAAAAAACCGGGCGGGGGGGGCCCTT
AAAAAATAGGGGCCCCCCCGGGGGGGGGAAATTTAAAAAAAAGTTTTTCCCCCCCCCCCCCCCCGGGGGGGGGCCCGGGCCCCATTTCCCCCTAA
GGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378655] SGN-U603923 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1910 [Download][View] Facility Assigned ID: TUS48J16.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.700 Expected Error Rate: 0.0222 Quality Trim Threshold: 20.5