EST details — SGN-C185897
| Search information |
| Request: 185897 | Match: SGN-C185897 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C185897 | Clone name: TUS-48-J7 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185897 is on microarray TOM1 spot ID 1-1-2.2.7.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C17129 [cLED-18-L3] | Trace: SGN-T53294 | EST: SGN-E237991 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C185897 [TUS-48-J7] | Trace: SGN-T192549 | EST: SGN-E391223 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E378819 | Length: 118 bp (1113 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E378819 [] (trimmed)
AAGTCGTCTGACTCTCTATCCAGCCAATGTCGCTGACATTGAGCCAGAGGTGAAGCAGATGGTTACCGTCTCCGGTCGTATCCGTGCGGAAGACG
GCACACTGCTGGCTAACGCACGG
GCACACTGCTGGCTAACGCACGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E378819] | SGN-U575025 | Tomato 200607 | Build 2 | 4 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T1912 [Download][View] | Facility Assigned ID: TUS48J7.ab1 |
| Submitter: Koni | Sequencing Facility: Giov. Lab |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 0 |
Working
