EST details — SGN-C185522

Search information 
Request: 185522Match: SGN-C185522
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C185522Clone name: TUS-47-J16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185522 is on microarray TOM1 spot ID 1-1-1.2.9.4 [Order] [Tomato Microarray Database]
See unigene SGN-U581507 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C75131 [cLES-12-P3] Trace: SGN-T100079 EST: SGN-E286548 Direction: 5' Facility: TIGR
Clone: SGN-C185522 [TUS-47-J16] Trace: SGN-T192677 EST: SGN-E391351 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E391165Length: 481 bp (924 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E391165 [] (trimmed) GAAAAATGAAGTTCAATATTGTATCACCCGTTGCACTGTCTTGTCTCTTTTTCTTGTTCCTAACAGGTACTTTAGCACAAAATGCCGGTTCCATT
GTAACGCGGGAATTGTTCGAACAAATGCTGAGTTTTAGGAACAATGACGCATGTCCTGCCAAAGGATTCTACACTTATGATGCATTCATAGCTGC
AGCCAATTCGTTTCCAGGTTTTGGTACTGCTGGTGATGATACTGCACGTAAGAAGGAAATTGCTGCCTTTTTCGGTCAAACATCTCACGAAACTA
ATGGTGGTAGTGCAGGAACATTCACTGGAGGATATTGCTTTGTTAAGCAAATAGAGCAGTCAGACAGATACTATGGCAGAGGACCTATCCAATTG
ACACACCAATCTAACTACGAACGAGCTGGACAAGGTATTGGTGTTGGAGAAGAGTTAGTGAACAACCCTGATTTATTTGCGACAGATCCTATAAT
ATCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E391165] SGN-U581507 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T192491 [Download][View] Facility Assigned ID: FA0AAD35DE08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0055 Quality Trim Threshold: 14.5