EST details — SGN-C185007
| Search information |
| Request: 185007 | Match: SGN-C185007 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C185007 | Clone name: TUS-46-E5 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185007 is on microarray TOM1 spot ID 1-1-4.1.12.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C3338 [cLEC-20-E13] | Trace: SGN-T27717 | EST: SGN-E205935 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C185007 [TUS-46-E5] | Trace: SGN-T198901 | EST: SGN-E397575 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E397576 | Length: 96 bp (996 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E397576 [] (trimmed - flagged)
TTGATTGTTATTGACCTTTAAGGACAGGCTGGAATGAATTTTCTTTCATAAGTTTTTAGTGTGCCATTCAACAGGCGGACTCGTGTCTTTAAAAA
A
A
| Unigenes |
| Current Unigene builds | |||||
| No current unigene builds incorporate this sequence |
| Chromatogram |
| SGN-ID: SGN-T198902 [Download][View] | Facility Assigned ID: FA0AAD34AC03RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
| Problems: | Possibly chimeric (anomalous insert into vector) |
| Sequence Entropy: 0.854 | Expected Error Rate: 0.0183 | Quality Trim Threshold: 14.5 |
Working
