EST details — SGN-C184987

Search information 
Request: 184987Match: SGN-C184987
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184987Clone name: TUS-46-D9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184987 is on microarray TOM1 spot ID 1-1-8.4.12.17 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72099 [cLER-1-C23] Trace: SGN-T91828 EST: SGN-E280274 Direction: 5' Facility: TIGR
Clone: SGN-C72099 [cLER-1-C23] Trace: SGN-T91829 EST: SGN-E280275 Direction: 3' Facility: TIGR
Clone: SGN-C184987 [TUS-46-D9] Trace: SGN-T199020 EST: SGN-E397694 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397695Length: 292 bp (916 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397695 [] (trimmed) GAGATTTTCGTCGACTTTGAAAAGTAAGGCTTCGATTATCGGATTTCCGAAGACTCAGAAGACTAGTTTCATCGATTCGAAACGGCGAACTTGTA
AACCGGCGAACATTAGGCTTTTCCCGGCGAAAAGGTCTGAATCTACGTTGAAATCGGCTTCGGTTACGGAACCGTCGTCACCGAAGGTATCTTGT
ATGGGAAGAGTAAGATCGAAACGTAGATCACGAAGCCGACGATCATCGGAGAAATCAAAAAAATGTGAAAAAAATTCCCTCTAGAGATCACGAAG
CAACAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397695] SGN-U574010 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199021 [Download][View] Facility Assigned ID: FA0AAD34CB05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5