EST details — SGN-C184909

Search information 
Request: 184909Match: SGN-C184909
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184909Clone name: TUS-46-A3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184909 is on microarray TOM1 spot ID 1-1-6.1.12.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C8248 [cLEC-4-N5] Trace: SGN-T24479 EST: SGN-E201529 Direction: 5' Facility: TIGR
Clone: SGN-C184909 [TUS-46-A3] Trace: SGN-T198876 EST: SGN-E397550 Direction: 5' Facility: INRA
Clone: SGN-C184909 [TUS-46-A3] Trace: SGN-T200073 EST: SGN-E398747 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378469Length: 236 bp (1100 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378469 [] (trimmed) ATATACCGATACAGCAATTATTAGGGATTTGTATATTATTTTTTCAGGTAAAATATACATTTACAACTATTGTTTTCTACAGCTCAGACGATATT
CAGCCATTACTCTTTCTCCGGAATTTGCTTCTCAAACATGTCTTACGCCTATCTCTTCAAGTATATCATCATCGGCGATACCGGAGTTGGAAATC
ATGTCTTCTGTTGCAATTACTGACAACGATTTCACCCAGTCATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378469] SGN-U562695 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1855 [Download][View] Facility Assigned ID: TUS46A3.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0058 Quality Trim Threshold: 20.5