EST details — SGN-C184675

Search information 
Request: 184675Match: SGN-C184675
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184675Clone name: TUS-45-G9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184675 is on microarray TOM1 spot ID 1-1-8.3.14.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C88507 [cLET-8-H21] Trace: SGN-T104384 EST: SGN-E290988 Direction: 5' Facility: TIGR
Clone: SGN-C184675 [TUS-45-G9] Trace: SGN-T198564 EST: SGN-E397238 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398683Length: 330 bp (896 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398683 [] (trimmed) TTACATTTGTAAGTGTATTGTGTCTTTCCATTTTAGCTCCAAATAGTCCTTTTGCAACCAAAATCTTGTCTGAGATTTTTCTATATTTGGGATTG
ATCTAAAGATATGGTTCGAGGTAAAACCCAGATGAGGCGTATAGAGAACGCCACAAGCAGACAAGTTACTTTCTCAAAGAGAAGAAATGGTTTGC
TAAAAAAAGCTTTTGAGCTTTCTGTCTTATGTGATGCTGAAGTGGGATTGATTATATTTTCTCCAAGAGGAAAACTATATGAATTTGCTAGTTCA
AGCATACCTGAGGTAATTGAACTATTTTTTAGGCATACTAGAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398683] SGN-U583095 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T200009 [Download][View] Facility Assigned ID: FA0AAD33AD05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0001 Quality Trim Threshold: 14.5