EST details — SGN-C184655

Search information 
Request: 184655Match: SGN-C184655
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184655Clone name: TUS-45-F13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184655 is on microarray TOM1 spot ID 1-1-4.2.14.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78444 [cLES-5-L1] Trace: SGN-T98150 EST: SGN-E285667 Direction: 5' Facility: TIGR
Clone: SGN-C184655 [TUS-45-F13] Trace: SGN-T198680 EST: SGN-E397354 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397355Length: 140 bp (928 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397355 [] (trimmed) GTTTTCTTTTTCCTACTCACCTCTCTGTATTTTTGTTTGAAACAGCAACAAGAAGATACCCTTTTTTGGGCTTTTCCTTGTGTTTTTTTGTGTAT
ATATAGAGGTAGGAGTTTGTGGGGTGTAAAAAAATTACACCTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397355] SGN-U570987 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198681 [Download][View] Facility Assigned ID: FA0AAD33CC07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.877 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5