Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C184430

Search information 
Request: 184430Match: SGN-C184430
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C184430Clone name: TUS-44-M4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184430 is on microarray TOM1 spot ID 1-1-5.1.16.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C21379 [cLED-33-G23] Trace: SGN-T56995 EST: SGN-E239722 Direction: 5' Facility: TIGR
Clone: SGN-C184430 [TUS-44-M4] Trace: SGN-T198205 EST: SGN-E396879 Direction: 3' Facility: INRA
Clone: SGN-C184430 [TUS-44-M4] Trace: SGN-T199964 EST: SGN-E398638 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E378632Length: 260 bp (1073 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E378632 [] (trimmed) GAAAAGAGGGAAAATTTGATCCTAGGGTTTACTATTTACGGTAAAAAATGGATGGTTCAGCTCCGCAAACGGATACGGTGATGTCGGATGCGGCG
GCGGGACAGCAACCTGCTATGCCGCCGCTGCCGATGGCCGGAATGGAGAATATTCCTGNCACGTTGAGTCACGGTGGCCGGTTTATTCAATACAA
TATTTTTGGTATATATTTGAAGTTACTGCGAAGTATAAGCCTCCATTTATGCCATCGGTAAAGGAGCTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E378632] SGN-U576602 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T1828 [Download][View] Facility Assigned ID: TUS44M4.ab1
Submitter: Koni Sequencing Facility: Giov. Lab
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0138 Quality Trim Threshold: 20.5