EST details — SGN-C184212
| Search information |
| Request: 184212 | Match: SGN-C184212 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C184212 | Clone name: TUS-44-D2 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C184212 is on microarray TOM1 spot ID 1-1-7.4.16.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C72447 [cLER-20-D18] | Trace: SGN-T96805 | EST: SGN-E285233 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C184212 [TUS-44-D2] | Trace: SGN-T198361 | EST: SGN-E397035 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E397036 | Length: 172 bp (919 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E397036 [] (trimmed)
TGGGGGTTGAATTTAAAAATATCCAATTTTTTCGAAGAGAAAAAAAAAGGATAATAAGTGCCTTCTACTCAATTATTTTTACTACTAATAAAGTC
CAAAAGAAATTTTCTTTGTAAGAAGAAAAAAAAATGCTAGAAAGTTCTGTTTTGTTGGAGAATACAGCTGCTGGTGG
CAAAAGAAATTTTCTTTGTAAGAAGAAAAAAAAATGCTAGAAAGTTCTGTTTTGTTGGAGAATACAGCTGCTGGTGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E397036] | SGN-U572185 | Tomato 200607 | Build 2 | 37 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T198362 [Download][View] | Facility Assigned ID: FA0AAD32DB01RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.866 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 14.5 |


