EST details — SGN-C183934
| Search information |
| Request: 183934 | Match: SGN-C183934 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C183934 | Clone name: TUS-43-H12 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183934 is on microarray TOM1 spot ID 1-1-5.4.19.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C7715 [cLEC-39-P4] | Trace: SGN-T31884 | EST: SGN-E208594 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183934 [TUS-43-H12] | Trace: SGN-T198108 | EST: SGN-E396782 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183934 [TUS-43-H12] | Trace: SGN-T199923 | EST: SGN-E398597 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E378221 | Length: 291 bp (1150 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E378221 [] (trimmed)
TATTATAACTATACTTCTGGTTACATCCACCACTGCAATATCAAAAATTTGAATTTCCCTACCAAATACTACTATAAGATTGGGATTGGACATAT
ATCACGAACCTTCTGGTTCACAACTCCTCCAGAAGTCGGCCCTGATGTACCCTATACATTTGGTCTTATAGGGGATCTTGGTCAGAGTTTTGATT
CAAACAAGACACTCACACATTATGAATTAAATCCCAATTAAGGGGCAGCAGTGTTGTTCGTAGGTGACTTATCTTATGCTGATAACTACCCTAAT
CATGAC
ATCACGAACCTTCTGGTTCACAACTCCTCCAGAAGTCGGCCCTGATGTACCCTATACATTTGGTCTTATAGGGGATCTTGGTCAGAGTTTTGATT
CAAACAAGACACTCACACATTATGAATTAAATCCCAATTAAGGGGCAGCAGTGTTGTTCGTAGGTGACTTATCTTATGCTGATAACTACCCTAAT
CATGAC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E378221] | SGN-U576865 | Tomato 200607 | Build 2 | 15 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T1794 [Download][View] | Facility Assigned ID: TUS43H12.ab1 |
| Submitter: Koni | Sequencing Facility: Giov. Lab |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.927 | Expected Error Rate: 0.0061 | Quality Trim Threshold: 20.5 |


