EST details — SGN-C183727

Search information 
Request: 183727Match: SGN-C183727
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C183727Clone name: TUS-42-O21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183727 is on microarray TOM1 spot ID 1-1-4.3.1.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34293 [cLEG-30-G5] Trace: SGN-T69021 EST: SGN-E255295 Direction: 5' Facility: TIGR
Clone: SGN-C183727 [TUS-42-O21] Trace: SGN-T194972 EST: SGN-E393646 Direction: 3' Facility: INRA
Clone: SGN-C183727 [TUS-42-O21] Trace: SGN-T199573 EST: SGN-E398247 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E399208Length: 99 bp (861 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E399208 [] (trimmed - flagged) CCTTGGTTCCTCATTTGATAGATTGATTTGCGTTTGTTTGCTGAAGGCACTGTTTGGATTTGGATTTGGATTTACACAACAACCATTGAATTTTT
TACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T199573 [Download][View] Facility Assigned ID: FA0AAD30AH11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (anomalous insert into vector)
Sequence Entropy: 0.820 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5