EST details — SGN-C18347

Search information 
Request: 18347Match: SGN-C18347
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C18347Clone name: cLED-23-A10
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C182516 is on microarray TOM1: SGN-S1-1-7.1.8.20
This clone has been mapped as P54.
Additional sequencing 
Clone: SGN-C182516 [TUS-39-M10] Trace: SGN-T194895 EST: SGN-E393569 Direction: 3' Facility: INRA
Clone: SGN-C182516 [TUS-39-M10] Trace: SGN-T194895 EST: SGN-E398822 Direction: 3' Facility: INRA
Clone: SGN-C182516 [TUS-39-M10] Trace: SGN-T194896 EST: SGN-E393570 Direction: 3' Facility: INRA
Clone: SGN-C182516 [TUS-39-M10] Trace: SGN-T194897 EST: SGN-E393571 Direction: 5' Facility: INRA
Clone: SGN-C182516 [TUS-39-M10] Trace: SGN-T200132 EST: SGN-E398823 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E239442Length: 441 bp (786 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E239442 [] (trimmed) GCATATCTTATCCATTCAACTCACTCAGATCGATCGATTCGATCGATGGGTCGAGGAAAGATAGAGATAAAGAGGATTGAAAACAACACAAATCG
ACAGGTAACATTCTGCAAGAGAAGAAATGGATTACTGAAAAAGGCATATGAACTTTCAGTTCTATGTGATGCTGAGATTGCTCTCATTGTTATCT
CTACTCGTGGTCGACTCTATGAATACTCTAACAACAATGTAAAGGCAACTATAGAACGATACAAAAAGGCAACAGCAGAAACGTCTAGTGCGTAC
ACTACTCAAGAGCTCAATGCACAGTTTTACCAACAAGAATCAAAGAAGGTGCGGCAACAGATACAAATGATGCAGAACACAAATAGGCATCTGGT
GGGTGAAGGGCTGAGCTCTTTGAATGTGAGGGAACTGAAGCAATTGGAGAACAGACTTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E239442] SGN-U585390 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T54407 [Download][View] Facility Assigned ID: TOVDL05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0198 Quality Trim Threshold: 14.5