EST details — SGN-C183432

Search information 
Request: 183432Match: SGN-C183432
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C183432Clone name: TUS-42-C14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183432 is on microarray TOM1 spot ID 1-1-3.3.1.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C100400 [cLEZ-8-B18] Trace: SGN-T122058 EST: SGN-E310092 Direction: 5' Facility: TIGR
Clone: SGN-C183432 [TUS-42-C14] Trace: SGN-T199671 EST: SGN-E398345 Direction: 3' Facility: INRA
Clone: SGN-C183432 [TUS-42-C14] Trace: SGN-T200453 EST: SGN-E399570 Direction: 5' Facility: INRA
Clone: SGN-C183432 [TUS-42-C14] Trace: SGN-T200277 EST: SGN-E399229 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394682Length: 394 bp (826 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394682 [] (trimmed) AGCAACAAATAATACTCAAACCTATCTTTCACACGTTAAAATTTCAAAAGAATCACCAATAAACAAACATATTACAAAGTGCCCTCCAACTTCAG
CTTTCCATTTCCTTGAGCTCATTTTTATGAACCACAACAAGCTGATTTCTGGGAAGTTTGACTACCTCCAGCTCCTGCTTCTGGTTGATTAATCT
TGAGTGTTGACGGCTCGGCCTTGGAGTCTGTGTCTGCAAGCCTTTGTTTTATATCTCTTGCTATTGAGAAGAAAACTTGTTTTTTGTTAAGATTT
GTCTTTGCACTAGTTTCGGGGGGGGGAGGTACATACTCTTCTGCAAGTGCTTGATTCTTTGCTGGACGGACAGCCTTCTTGGCTGTCATCCATGA
CGGGCGGGGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394682] SGN-U578498 Tomato 200607 Build 2 40 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196008 [Download][View] Facility Assigned ID: FA0AAD30BB07RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0112 Quality Trim Threshold: 14.5