EST details — SGN-C182111
Search information |
Request: 182111 | Match: SGN-C182111 |
Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
Clone information |
SGN ID: SGN-C182111 | Clone name: TUS-38-L13 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C182111 is on microarray TOM1 spot ID 1-1-4.4.10.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C80372 [cLET-12-A19] | Trace: SGN-T105491 | EST: SGN-E293028 | Direction: 5' | Facility: TIGR |
Clone: SGN-C182111 [TUS-38-L13] | Trace: SGN-T194722 | EST: SGN-E393396 | Direction: 3' | Facility: INRA |
Sequence |
Sequence Id: SGN-E398004 | Length: 105 bp (924 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E398004 [] (trimmed)
GGCACTCTTCTTTCTTTGCTGGTTATAGGCCACAGTTTTACATGAGAACAACTGATGTGACCGGAAAGGTTACTGCTCTTTTGACAGACAACGTA
TAAATATCTC
TAAATATCTC
Unigenes |
Current Unigene builds | |||||
[SGN-E398004] | SGN-U593231 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T199330 [Download][View] | Facility Assigned ID: FA0AAD26CF07RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.939 | Expected Error Rate: 0.0210 | Quality Trim Threshold: 14.5 |