Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C182111

Search information 
Request: 182111Match: SGN-C182111
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182111Clone name: TUS-38-L13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182111 is on microarray TOM1 spot ID 1-1-4.4.10.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80372 [cLET-12-A19] Trace: SGN-T105491 EST: SGN-E293028 Direction: 5' Facility: TIGR
Clone: SGN-C182111 [TUS-38-L13] Trace: SGN-T194722 EST: SGN-E393396 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E398004Length: 105 bp (924 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E398004 [] (trimmed) GGCACTCTTCTTTCTTTGCTGGTTATAGGCCACAGTTTTACATGAGAACAACTGATGTGACCGGAAAGGTTACTGCTCTTTTGACAGACAACGTA
TAAATATCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E398004] SGN-U593231 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199330 [Download][View] Facility Assigned ID: FA0AAD26CF07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0210 Quality Trim Threshold: 14.5