EST details — SGN-C182013

Search information 
Request: 182013Match: SGN-C182013
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C182013Clone name: TUS-38-H11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182013 is on microarray TOM1 spot ID 1-1-6.4.10.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C88606 [cLET-8-M3] Trace: SGN-T104468 EST: SGN-E291072 Direction: 5' Facility: TIGR
Clone: SGN-C182013 [TUS-38-H11] Trace: SGN-T199367 EST: SGN-E398041 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393130Length: 515 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E393130 [] (trimmed) AAACACAAAGAGATTGAAAAATAAAACACATATTCATTCTTTAATAATCTTAGAGTTTTTTTTTTTTGCAACAATGGCTTCCACCATGATGACTA
CTCTACCACAGTTCAATGGACTCAAACCCCAACCTTTCTCAGCTTCTCCAATTCAAGGCTTGGTGGCAATTCAACCAAGACGCAACAAAGGACAA
GGTGGTTTGGGAGCTCGTTGTGATTTCATTGGCTCATCCACTAATTTGATAATGGTGACATCAACAAGCCTGATGTTGTTTGCTGGTAGATTTGG
TCTAGCACCATCAGCAAACAGGAAGGCAACTGCAGGGCTAAAACTTGAAGTGAGGGACTCTGGGTTACAGACAGGGGACCCTGCTGGATTTACAC
TTGCTGATACTTTGGCTTGTGGTACTGTGGGTCATATTATTGGTGTTGGAGTTGTTCTTGGACTCAAAAACATTGGTGCTCTCTAAAATTTGTAT
TACTCCTTATGTTTATAAGAAAAACAAATCATCTTTTGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393130] SGN-U575975 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T194456 [Download][View] Facility Assigned ID: FA0AAD26CD06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5